Intrageniczna delecja genu KALIG-1 w zespole Kallmanna cd

Startery oligonukleotydowe stosowane w reakcji PCR były T312A (sekwencja, 5 CTTTCTAAGGTGCTAGCTAAGCC3 ) i 5771BP (sekwencja, 5 AGGGATTCATGCTCAAGGTATATTC3 ). Produkt PCR następnie subklonowano w wektorze M13 zgodnie ze standardowymi technikami 26 i sekwencjonowano przy użyciu fluorescencyjnego sekwencera Applied Biosystem ABI 370A, jak opisano w Gibbs et al.27. Wyniki
Ryc. 1. Wyniki analizy Southern Blot i amplifikacji PCR genu KALIG-1 u członków rodziny z zespołem Kallmanna powiązanym z chromosomem X. Panel A pokazuje analizę Southern blot genomowego DNA strawionego EcoRI za pomocą sondy (N1.4) 22 z końca 3 genu KALIG-1. Sonda rozpoznaje zarówno prążek specyficzny dla X o wielkości 12,5 kb, jak i prążek specyficzny dla Y o wielkości 20 kb u normalnych osobników płci męskiej (ten ostatni pas odpowiada sekwencjom homologicznym do KALIG-1 umiejscowionego na chromosomie Y). W próbkach DNA od dwóch pacjentów z zespołem (stałe kwadraty) i ich matki, sonda również rozpoznała fragment restrykcyjny o zmienionej wielkości (9,5 kb) odpowiadający usuniętemu chromosomowi X; ten fragment jest oznaczony del (X) .
Panel B pokazuje amplifikację PCR końca 3 genu KALIG-1. Zarówno proband (stały kwadrat) jak i jego matka posiadały produkt amplifikacyjny o wielkości 800 bp, który obejmował skrzyżowanie delecji. Babcia i ciotka pacjenta nie miały fragmentu skrzyżowania o 800 pz, co wskazuje, że nie niosły usunięcia. Słaby pas 4-kb jest widoczny na ścieżce reprezentującej DNA z klonu drożdżowego z chromosomem sztucznym (YAC) obejmującym region (YAC X2) 22; ten pas 4-kb nie jest widoczny na ścieżce reprezentującej DNA od normalnego osobnika płci męskiej (.), ponieważ duży fragment jest trudny do amplifikacji przez PCR. MW oznacza znacznik masy cząsteczkowej (PhiX-HaeIII) i H20, kontrolę wody ( brak reakcji DNA w celu sprawdzenia zanieczyszczenia PCR).
Analiza Southern błot DNA od 77 niepowiązanych pacjentów z zespołem Kallmanna z użyciem sondy zawierającej cały region kodujący KALIG-1 (p23A) wykazała dowody na delecję genu KALIG-1 tylko w jednej rodzinie. Prawdopodobnie odzwierciedla to fakty, że zespół Kallmanna jest genetycznie heterogenny10 i że duże delecje są rzadkie u pacjentów z syndromem związanym z chromosomem X. Po hybrydyzacji z sondą DNA od Pacjentów i 2 i ich matki miało fragment restrykcyjny o zmienionym rozmiarze, co wskazuje, że delecja dotyczyła końca 3 genu. Aby to potwierdzić, wykorzystaliśmy następnie sondę odpowiadającą końce 3 genu KALIG-1 (N1.4). Figura 1A pokazuje analizę DNA od trzech członków rodziny i człowieka nie dotkniętego chorobą za pomocą trawienia EcoRI i sondy N1.4. W DNA pacjentów brakowało normalnego specyficznego dla X pasma hybrydyzacji o w przybliżeniu 12,5 kb zawierającego ostatnie pięć egzonów, a także część 3 nieulegającego translacji regionu genu KALIG-1 22, 23 (i danych niepublikowanych), ale miało nieprawidłowy wynik. fragment około 9,5 kb, co sugeruje delecję około 3 kb. Nieprawidłowy fragment 9,5 kb wykryto również w DNA matki, co wskazuje, że nosiła ona delecję. Analiza DNA pacjentów za pomocą sondy odpowiadającej regionowi genu, który znajduje się po stronie 3 N1.4, wykazała prążki do hybrydyzacji o normalnej wielkości, co wskazuje, że delecja była całkowicie zawarta w genie KALIG-1 (dane nie pokazane).
Rysunek 2
[przypisy: jak rozróżnić kota od kotki, stomatolog na nfz kraków, miłość z netu cda ]