Mutacje bzdur w genie BCS1L jako przyczyna zespołu Björnstad ad 9

Co więcej, aktywność łańcucha transportującego elektrony, oceniana pośrednio przez analizę komplementacji drożdży lub mitochondriów ze zmutowanych limfocytów, różniła się jedynie umiarkowanie między mitochondriami z mutacjami powodującymi zespół Björnstad i mitochondriami z mutacjami CIII. Jednak tylko mutacje CIII prowadziły do kompensacyjnego wzrostu zawartości mitochondriów w limfocytach, co prawdopodobnie odzwierciedla bardziej poważny defekt łańcucha transportującego elektrony. Niepożądanym skutkiem nieodpowiedniej aktywności łańcucha transportującego elektrony i zwiększonej zawartości mitochondriów była zwiększona produkcja reaktywnych form tlenu. Stwierdziliśmy, że wszystkie mutacje BCS1L zmniejszały wytwarzanie nadtlenku za pośrednictwem kompleksu III, co odzwierciedlało zmniejszone tworzenie kompleksu III z powodu upośledzonej insercji białka Rieske Fe / S; model ten jest wspierany przez badania, które bezpośrednio implikują białko Rieske Fe / S w produkcji reaktywnych form tlenu. Przeciwnie, wytwarzanie ponadtlenku przez kompleks I było uderzająco wyższe w mitochondriach z mutacjami CIII niż w tych z mutacjami związanymi z zespołem Björnstad ( P = 0,04) (Figura 5). Read more „Mutacje bzdur w genie BCS1L jako przyczyna zespołu Björnstad ad 9”

Zmniejszenie poziomu RNA wirusa HIV-1 za pomocą terapii w celu powstrzymania wirusa Herpes Simplex ad 7

Co więcej, analiza mnożników wirusa z powtarzanymi pomiarami pozwoliła na dostosowanie do zmienności osobniczej HSV-2 i uwalniania wirusa HIV-1, co widać w fazie wyjściowej. Chociaż nasze badanie kliniczne nie miało wyników klinicznych dotyczących HIV, jego wyniki mogą mieć znaczenie w zapobieganiu i leczeniu HIV-1. Szacuje się, że znaczna część osób seropozytywnych wobec HIV-1 jest również seropozytywna HSV-2. [27] Silne i znaczące zmniejszenie poziomów RNA HIV-1 w osoczu i narządach płciowych związanych z leczeniem walacyklowirem sugeruje, że utrzymujące się formy HSV -2 kontrola (leczenie przeciwwirusowe lub skuteczne szczepienie) może zmniejszyć transmisję wirusa HIV-1, zakładając, że obniżenie poziomu RNA HIV-1 w genitaliach i osoczu jest czynnikiem zmniejszającym transmisję.19,41 To odkrycie może być szczególnie istotne w populacjach odgrywać istotną rolę w dynamice transmisji HIV i wśród par z niezgodnym stanem HIV.19 Na poziomie indywidualnym, zmniejszenie poziomów RNA HIV-1 w osoczu (z prawdopodobnym zmniejszeniem aktywacji CD4 +, odpowiedzialnym za limfocyt T depletion42) może prowadzić do korzyści immunologicznych przez dłuższy czas leczenia walacyklowirem, tym samym spowalniając przebieg choroby HIV-1. Oprócz korzyści indywidualnych związanych z nawrotem klinicznym, leczenie supresyjne HSV może również mieć wpływ na transmisję HSV-2 .43
Związek pomiędzy HSV-2 i HIV-1 powinien stymulować rozwój i ocenę metod kontroli HSV-2. Read more „Zmniejszenie poziomu RNA wirusa HIV-1 za pomocą terapii w celu powstrzymania wirusa Herpes Simplex ad 7”

Wykorzystanie fragmentów Fab specyficznych dla digoksyny do intensywnego zatrucia u dzieci ad

Jeśli stężenie digoksyny w osoczu w surowicy było nieznane, ale istniała wiarygodna informacja na temat ilości spożywanej, dawka Fab opierała się na fakcie, że 40 mg (jedna fiolka) Fab wiąże około 0,66 mg digoksyny. Fab podano dożylnie; Przed podaniem zalecono wykonanie testu skórnego w kierunku reakcji nadwrażliwości. Czas, w którym rozpoczęto terapię Fab, odnotowano, a gdy to możliwe w przypadku ostrych zatruć, rejestrowano również czas od ekspozycji na digoksynę do rozpoczęcia terapii Fab. Stężenie potasu w surowicy monitorowano przez 48 do 72 godzin po terapii Fab. Opisano również dalszy przebieg i przeżycie każdego pacjenta. Read more „Wykorzystanie fragmentów Fab specyficznych dla digoksyny do intensywnego zatrucia u dzieci ad”

Intrageniczna delecja genu KALIG-1 w zespole Kallmanna cd

Startery oligonukleotydowe stosowane w reakcji PCR były T312A (sekwencja, 5 CTTTCTAAGGTGCTAGCTAAGCC3 ) i 5771BP (sekwencja, 5 AGGGATTCATGCTCAAGGTATATTC3 ). Produkt PCR następnie subklonowano w wektorze M13 zgodnie ze standardowymi technikami 26 i sekwencjonowano przy użyciu fluorescencyjnego sekwencera Applied Biosystem ABI 370A, jak opisano w Gibbs et al.27. Wyniki
Ryc. 1. Wyniki analizy Southern Blot i amplifikacji PCR genu KALIG-1 u członków rodziny z zespołem Kallmanna powiązanym z chromosomem X. Read more „Intrageniczna delecja genu KALIG-1 w zespole Kallmanna cd”

Intrageniczna delecja genu KALIG-1 w zespole Kallmanna

Syndrom KALLMANNA jest dziedzicznym zaburzeniem charakteryzującym się hipogonadyzmem i anosmią1. Hipogonadyzm spowodowany jest niedoborem hormonu uwalniającego gonadotropinę (GnRH), 2, a anosmia jest wynikiem hipoplazji lub aplazji węchowych przewodów i przewodów nerwowych.3, 4 Ponadto w hipogonadyzmie hipogonadotropowym i anosmii, u pacjentów z zespołem Kallmanna mogą występować inne nieprawidłowości. Obejmują one deficyty neurologiczne, takie jak synkineza, 1, 5 zaburzeń uwagi przestrzennej, 6 paraplegii spastycznej, 7 dysfunkcji móżdżku, oczopląs oczny wywołany spojrzeniem, pes cavus, 5, 8 upośledzenie umysłowe, 9 zaburzeń widzenia i utraty słuchu, 10 i inne defekty somatyczne, takie jak jednostronna agenezja nerek, 9 podków nerkowych, 11 wnętrostwo, 12 i rozszczep wargi i podniebienia. [10] Stwierdzono, że kilka z tych zaburzeń oddziela się jako cechy mendelowe w związku z zespołem Kallmanna, co sugeruje, że nie reprezentują one szansy skojarzenia. ale mogą być składnikami zaburzenia5, 9, 13 Zespół Kallmanna dotyka na 10 000 do na 60 000 osób.14, 15 Chociaż występuje znaczny nadmiar mężczyzn w stosunku do kobiet, co sugeruje przewagę rodzin ze wzorem dziedziczonego przez X, 14 rodzin z wzorami autosomalnie dominujących i odnotowano dziedziczenie autosomalne-recesywne, 10, 16 wskazujące na genetyczną heterogenność tej choroby. Read more „Intrageniczna delecja genu KALIG-1 w zespole Kallmanna”

Transplantacja nerki u dzieci – raport z amerykańskiego badania pediatrycznego przeszczepu nerek

PRZEWLEKŁA choroba nerek u dzieci jest często spowodowana wrodzonym uszkodzeniem nerek, takim jak aplazja lub dysplazja, co prowadzi do schyłkowej niewydolności nerek we wczesnym dzieciństwie. Takie dzieci mają opóźniony wzrost i osteodystrofię nerek. Terapia za pomocą dializy prowadzi do zaostrzenia choroby kości nerkowej i prowadzi do wczesnego zamknięcia nasad kości przednich. Aby uniknąć tego dodatkowego urazu, lekarze często wolą wykonywać przeszczep nerki tak szybko, jak to możliwe, nawet przed rozpoczęciem dializy. Ze względu na niewielką liczbę procedur wykonywanych co roku w poszczególnych ośrodkach dane na temat wyników przeszczepienia nerki u dzieci są rzadkie. Read more „Transplantacja nerki u dzieci – raport z amerykańskiego badania pediatrycznego przeszczepu nerek”

Principles of Neural Science Manter i Gatzs Essentials of Clinical Neuroanatomy and Neurophysiology Basic Neuroscience: Anatomia i fizjologia Core Text of Neuroanatomy Neuron: Cell and molecular biology cd

Po pierwsze, firmy dokonują uzgodnień dotyczących opłat licencyjnych z autorami różnych książek. Kierownik kursu może wybrać rozdziały z dowolnej książki na liście, a firma przygotuje następnie podręcznik do zamówienia zawierający wybrane rozdziały z wielu książek. Studenci kupują powstałą książkę, a dochód jest przekazywany pierwotnym autorom jako tantiemy. Gdybym miał taką opcję, wybrałbym wiele materiałów dotyczących fizjologii z Kandel, Schwartz i Jessell, a także ich rozdziałów na temat korelacji klinicznych, które zintegruję z bardziej szczegółową dyskusją na temat anatomii. Sekcje anatomii nie pochodzą z żadnej z wymienionych tu książek. Read more „Principles of Neural Science Manter i Gatzs Essentials of Clinical Neuroanatomy and Neurophysiology Basic Neuroscience: Anatomia i fizjologia Core Text of Neuroanatomy Neuron: Cell and molecular biology cd”

Więcej o jednostkach SI

Artykuł Christie i Marallo na temat nawrócenia na jednostki Syst.me International (SI) jest kolejnym silnym zarzutem, aby się z tym pogodzić. Chociaż kwestia jednostek SI była kontrowersyjna, autorzy zdecydowali się nie uznawać słuszności poglądów innych, których cechują ich ciągłe kłótnie, ciągnięcie stóp i bardzo nierówna współpraca .
Przypuśćmy na razie, że wśród włóczęgów i draggersów są po części inteligentni lekarze. Dlaczego zaciągają się nogami. Czy mogą istnieć rzeczywiste problemy i prawdziwe powody. Read more „Więcej o jednostkach SI”

Jak daleko obniżyć ciśnienie krwi

Fletcher i Bulpitt (wydanie z 23 stycznia) konkludują, że wydaje się rozsądne obniżenie ciśnienia rozkurczowego do wartości poniżej 85 mm Hg , jednak ich liczba pokazuje, że najniższy wskaźnik śmiertelności z powodu choroby wieńcowej obserwowano przy rozkurczowym ciśnieniu około 83 mm Hg oraz że śmiertelność wzrosła poniżej tego poziomu. Dlatego należy podkreślić ich dodatkowy wniosek, że nie jest jasne, jak daleko należy obniżyć ciśnienie rozkurczowe poniżej 85 mm Hg, i należy ich ostrzec, aby nie zalecali lekarzom beztrosko obniżania ciśnienia rozkurczowego poniżej 85 mm Hg do czasu uzyskania dalszych dowodów.
Jeszcze więcej uwagi wymaga zaakceptowanie stwierdzenia, że ciśnienie skurczowe powinno być obniżone do poniżej 125 mm Hg. Nie podają żadnych wytycznych dotyczących wieku pacjentów, którzy mają być leczeni. W żadnym badaniu starszych pacjentów z przewagą nadciśnienia skurczowego nie zbadano ryzyka redukcji do tak niskiego poziomu. Read more „Jak daleko obniżyć ciśnienie krwi”

Diagnostyka prenatalna choroby Wilsona przez analizę polimorfizmu DNA

Choroba Wilsona jest autosomalnym recesywnym zaburzeniem metabolizmu miedzi, charakteryzującym się gromadzeniem się miedzi w wątrobie, mózgu i innych narządach. Przyczyna usterki nie jest znana. Nie jest możliwe zidentyfikowanie nosicieli za pomocą konwencjonalnych metod biochemicznych.1, 2
Locus choroby Wilsona (WND) został zlokalizowany na chromosomie 13 (pasmo q14). Stwierdzono, że kilka polimorficznych markerów DNA jest ściśle związanych z locus WND.3, 4 Kolejność najbliższych polimorficznych loci, oparta na analizie sprzężeń w kilku rodzinach z chorobą Wilsona, jest następująca: centromer, retinoblastoma, D13S31, D13S59, WND , D13S55, D13S26, telomere.5 W ostatnich badaniach wykazano możliwość wykrywania nosicieli i diagnozy przedobjawowej choroby Wilsona poprzez analizę polimorfizmów z fragmentacją restrykcyjną (RFLP) .6, 7
Rysunek 1. Rysunek 1. Read more „Diagnostyka prenatalna choroby Wilsona przez analizę polimorfizmu DNA”