Mutacje bzdur w genie BCS1L jako przyczyna zespołu Björnstad ad 8

Zredukowana aktywność łańcucha transportu elektronów nie odzwierciedlała zawartości mitochondriów. Limfocyty z mutacją CIII miały 16% więcej mitochondriów na komórkę niż limfocyty od pacjentów z zespołem Björnstad lub prawidłowymi limfocytami (P = 0,02). Produkcja reaktywnych form tlenu
Oceniliśmy produkcję reaktywnych form tlenu z kompleksów I i III.31 W porównaniu z ilością nadtlenku wytwarzanego przez normalne mitochondria limfocytowe, ilość nadtlenku wytworzonego przez aktywność kompleksu III została zmniejszona o 61% w mitochondriach od pacjentów z zespołem Björnstad (P = 0,01) i 68% w mitochondriach od pacjentów z mutacją CIII (P = 0,02); ilości tych redukcji pokrywały się ze zmniejszonymi działaniami łańcucha transportu elektronów. Kompleks I wytwarza zaniedbywalny ponadtlenek w prawidłowym układzie oddechowym, 32 ale kompleks I w mitochondriach z mutacjami wywołującymi zespół Björnstada wytworzył 30 razy więcej nadtlenku niż normalnie (P = 0,01) (Figura 5C). Ilość nadtlenku wytwarzanego przez kompleks I w mitochondriach z mutacją CIII była jeszcze wyższa (50 razy większa od normalnej, P = 0,01) i była znacznie większa niż ta wytwarzana przez mitochondria z mutacjami wywołującymi zespół Björnstad (P = 0,04). Read more „Mutacje bzdur w genie BCS1L jako przyczyna zespołu Björnstad ad 8”

Zmniejszenie poziomu RNA wirusa HIV-1 za pomocą terapii w celu powstrzymania wirusa Herpes Simplex ad 6

Znacznie mniej kobiet w grupie walacyklowiru zrzuciło HSV-2 w ogóle w trakcie fazy leczenia: 19,1% w grupie walacyklowiru w porównaniu z 54,4% w grupie placebo (współczynnik ryzyka 0,35; 95% CI, 0,21 do 0,60; P <0,001) . Ponadto częstość wykrywania genitalnego DNA HSV-2 była silnie zmniejszona w grupie walacyklowiru (iloraz szans, 0,17, 95% CI, 0,07 do 0,38, P <0,001) (tabela 2). Wyniki zostały potwierdzone za pomocą analizy powtarzanych pomiarów (tabela 2). W podobny sposób odsetek kobiet z co najmniej jednym wrzodem narządów płciowych zmniejszył się w stosunku do wartości wyjściowej w grupie otrzymującej walacyklowir, z 29,4% w fazie początkowej do 4,4% w fazie leczenia, w porównaniu z brakiem zmian w grupie placebo (współczynnik ryzyka 0,16; 95% CI, 0,05 do 0,49; P = 0,002). Dyskusja
Codzienne leczenie walacyklowirem przez 3 miesiące znacznie zmniejszyło uwalnianie RNA HIV-1, zmniejszyło poziom RNA HIV-1 w osoczu i zmniejszyło poziomy RNA HIV-1 narządów płciowych, gdy zrzucanie występowało u kobiet podwójnie zakażonych wirusem HIV-1 i HSV-2. Read more „Zmniejszenie poziomu RNA wirusa HIV-1 za pomocą terapii w celu powstrzymania wirusa Herpes Simplex ad 6”

Wykorzystanie fragmentów Fab specyficznych dla digoksyny do intensywnego zatrucia u dzieci ad 5

Nasi pacjenci byli również bardziej odurzeni i często mieli inne obezwładniające problemy medyczne; nie jest zaskakujące, że zaobserwowaliśmy 24 procentowy wskaźnik śmiertelności, podczas gdy Lewander i in. nie zaobserwowano zgonów9. Nasz protokół rejestracji i czas potrzebny do uzyskania Fab dla pacjenta we wczesnych latach badania wyjaśniają czasami długi okres między diagnozą zatrucia naparstnicą a terapią Fab. Zaobserwowaliśmy znaczący spadek stężenia potasu w surowicy po podaniu Fab. Hamowanie pompy bounododowej przez naparstnicę powoduje utratę wewnątrzkomórkowego potasu do przestrzeni pozakomórkowej, skąd jest wydalane przez nerki, powodując podwyższone stężenia potasu w surowicy, ale całkowite zubożenie.39 Gdy toksyczność jest szybko odwracana przez Fab, całkowity deficyt potasu w organizmie odzwierciedla się jako hipokaliemia. Read more „Wykorzystanie fragmentów Fab specyficznych dla digoksyny do intensywnego zatrucia u dzieci ad 5”

Intrageniczna delecja genu KALIG-1 w zespole Kallmanna cd

Startery oligonukleotydowe stosowane w reakcji PCR były T312A (sekwencja, 5 CTTTCTAAGGTGCTAGCTAAGCC3 ) i 5771BP (sekwencja, 5 AGGGATTCATGCTCAAGGTATATTC3 ). Produkt PCR następnie subklonowano w wektorze M13 zgodnie ze standardowymi technikami 26 i sekwencjonowano przy użyciu fluorescencyjnego sekwencera Applied Biosystem ABI 370A, jak opisano w Gibbs et al.27. Wyniki
Ryc. 1. Wyniki analizy Southern Blot i amplifikacji PCR genu KALIG-1 u członków rodziny z zespołem Kallmanna powiązanym z chromosomem X. Read more „Intrageniczna delecja genu KALIG-1 w zespole Kallmanna cd”

Intrageniczna delecja genu KALIG-1 w zespole Kallmanna

Syndrom KALLMANNA jest dziedzicznym zaburzeniem charakteryzującym się hipogonadyzmem i anosmią1. Hipogonadyzm spowodowany jest niedoborem hormonu uwalniającego gonadotropinę (GnRH), 2, a anosmia jest wynikiem hipoplazji lub aplazji węchowych przewodów i przewodów nerwowych.3, 4 Ponadto w hipogonadyzmie hipogonadotropowym i anosmii, u pacjentów z zespołem Kallmanna mogą występować inne nieprawidłowości. Obejmują one deficyty neurologiczne, takie jak synkineza, 1, 5 zaburzeń uwagi przestrzennej, 6 paraplegii spastycznej, 7 dysfunkcji móżdżku, oczopląs oczny wywołany spojrzeniem, pes cavus, 5, 8 upośledzenie umysłowe, 9 zaburzeń widzenia i utraty słuchu, 10 i inne defekty somatyczne, takie jak jednostronna agenezja nerek, 9 podków nerkowych, 11 wnętrostwo, 12 i rozszczep wargi i podniebienia. [10] Stwierdzono, że kilka z tych zaburzeń oddziela się jako cechy mendelowe w związku z zespołem Kallmanna, co sugeruje, że nie reprezentują one szansy skojarzenia. ale mogą być składnikami zaburzenia5, 9, 13 Zespół Kallmanna dotyka na 10 000 do na 60 000 osób.14, 15 Chociaż występuje znaczny nadmiar mężczyzn w stosunku do kobiet, co sugeruje przewagę rodzin ze wzorem dziedziczonego przez X, 14 rodzin z wzorami autosomalnie dominujących i odnotowano dziedziczenie autosomalne-recesywne, 10, 16 wskazujące na genetyczną heterogenność tej choroby. Read more „Intrageniczna delecja genu KALIG-1 w zespole Kallmanna”

Transplantacja nerki u dzieci – raport z amerykańskiego badania pediatrycznego przeszczepu nerek ad 5

Dane o wysokości na koniec każdego sześciomiesięcznego okresu przeliczono na wynik odchylenia standardowego (wynik z) według następującego wzoru: wysokość pacjenta – wysokość w 50. percentylu dla wieku i płci. z score =
standardowe odchylenie wysokości dla wieku i płci
Standaryzacja została osiągnięta dzięki wykorzystaniu danych normatywnych z Narodowego Centrum Statystyki Zdrowia.
W momencie przeszczepienia średnia wysokość dla wszystkich pacjentów wynosiła 2,2 SD poniżej odpowiedniej średniej wieku i płci właściwej dla prawidłowych dzieci i młodzieży (punktacja z). Deficyt ten był porównywalny u obu płci, chociaż był większy u młodszych pacjentów (- 2,8 SD u pacjentów .5 lat) oraz u osób z wcześniejszymi przeszczepami (- 3,2 SD). Read more „Transplantacja nerki u dzieci – raport z amerykańskiego badania pediatrycznego przeszczepu nerek ad 5”

Zespół nadpobudliwości psychoruchowej z deficytem uwagi: kliniczny przewodnik po diagnostyce i leczeniu

Psychiatrzy i neurolodzy, szczególnie ci, którzy mają do czynienia z dziećmi, często mają na pierwszy rzut oka sprzeczne poglądy wielu pacjentów, których dzielą. Zapytaj psychiatrę, czy autystyczne dzieci mają normalną inteligencję, a odpowiedź brzmi tak ; zadaj neurologowi to samo pytanie, a odpowiedź zdecydowanie nie będzie. Wiele z tych widocznych sprzeczności znajduje się po bliższym zbadaniu wynikającym z błędu w próbkach. Tak jak pacjent z rozszczepem podniebienia poszukuje pomocy chirurga ortopedycznego, chirurga uszu, nosa i gardła lub chirurga plastycznego, zgodnie z którym objawy są najbardziej kłopotliwe, więc psychiatra i neurolog zbudują swoje wrażenia z uderzająco różnych aspektów tej samej choroby. Ta różnica jest nigdzie bardziej widoczna niż w przypadku dzieci, które są nadaktywne i nieuważne. Read more „Zespół nadpobudliwości psychoruchowej z deficytem uwagi: kliniczny przewodnik po diagnostyce i leczeniu”

Salmeterol i propionian flutykazonu i przeżycie w przewlekłej obturacyjnej chorobie płuc ad 7

Ogółem, 26% pacjentów było hospitalizowanych co najmniej raz w ciągu 3-letniego okresu badania. Roczne odsetki przyjęć były o 17% niższe w grupach złożonych i salmeterolu niż w grupie placebo (P.0,03) (tabela 2), co odpowiada liczbie potrzebnej do leczenia 32 pacjentów, aby zapobiec jednej hospitalizacji w ciągu roku. Tabela 3. Tabela 3. Inne wyniki skuteczności. Read more „Salmeterol i propionian flutykazonu i przeżycie w przewlekłej obturacyjnej chorobie płuc ad 7”

Synteza DNA i naprawy genów RRM1 i ERCC1 w raku płuc ad 6

Zwiększona ekspresja RRM1 zmniejsza tworzenie przerzutów, hamuje rozwój nowotworów płuc wywołanych rakotwórczością i przedłuża przeżycie u myszy z nowotworem.12-14 Związek pomiędzy wysoką ekspresją RRM1, jak określono za pomocą ilościowego RT w czasie rzeczywistym. -PCR i przedłużone przeżycie odnotowano u pacjentów z niedrobnokomórkowym rakiem płuc.11 Podobne dane zgłoszono dla ERCC1.24 Wyniki z małych zestawów danych sugerują koordynacyjną ekspresję RRM1 i ERCC1 w niedrobnokomórkowym raku płuc. .17,26 Ostatnie dane dostarczyły dowodów na silny związek między ekspresją jądrowego ERCC1, mierzoną za pomocą wizualnej oceny immunohistochemicznej, a wynikami klinicznymi. Analiza białka RRM1 w niedrobnokomórkowym raku płuca nie była możliwa do tej pory z powodu ograniczeń technicznych. Nasze badanie wykazało, że białko RRM1 w niedrobnokomórkowych komórkach raka płuc jest jądrowe, silnie skorelowane z ekspresją ERCC1 i znacząco związane z wolnym od choroby i całkowitego przeżycia. Read more „Synteza DNA i naprawy genów RRM1 i ERCC1 w raku płuc ad 6”