Mutacje bzdur w genie BCS1L jako przyczyna zespołu Björnstad cd

Kompleksy poddano elektroforezie błękitu poliakryloamidowego o niebieskim zabarwieniu, jak opisano uprzednio.9. Western bloty kompleksów białkowych sondowano przeciwciałami przeciwko BCS1L, białkom rdzeniowym i białkom R / Fe / S Rieske. Przed przeprowadzeniem analiz Western blot z użyciem przeciwciała Rieske Fe / S (Invitrogen Molecular Probes) próbki pobierano w drugim wymiarze elektroforezy w żelu poliakryloamidowym z dodecylosiarczanem sodu. Zawartość mitochondriów oceniano przez barwienie stransformowanych limfocytów za pomocą MitoTracker Green FM i hydroethidium w celu normalizacji liczby komórek (Invitrogen Molecular Probes). Transport łańcucha elektronowego
Szybkość redukcji barwnika resazuryny, który był zależny od łańcucha transportu elektronów, mierzono spektrofotometrycznie limfocytów traktowanych inhibitorem syntazy F1-ATP oligomycyną, jak opisano wcześniej18. Read more „Mutacje bzdur w genie BCS1L jako przyczyna zespołu Björnstad cd”

Zmniejszenie poziomu RNA wirusa HIV-1 za pomocą terapii w celu powstrzymania wirusa Herpes Simplex

Dane epidemiologiczne sugerują, że zakażenie wirusem opryszczki pospolitej typu 2 (HSV-2) wiąże się ze zwiększonym wydzielaniem genów ludzkiego wirusa niedoboru odporności typu (HIV-1) i transmisją HIV-1. Metody
Przeprowadziliśmy randomizowaną, podwójnie zaślepioną, kontrolowaną placebo próbę terapii supresyjnej HSV walacyklowirem (w dawce 500 mg dwa razy dziennie) w Burkina Faso wśród kobiet, które były seropozytywne w kierunku HIV-1 i HSV-2; wszyscy nie kwalifikowali się do wysoce aktywnej terapii antyretrowirusowej. Pacjentów obserwowano przez 24 tygodnie (12 tygodni przed i 12 tygodni po randomizacji). Modele regresji wykorzystano do oceny wpływu walacyklowiru na obecność i ilość DNA HIV-1 narządów płciowych i osocza oraz DNA HSV-2 narządów płciowych podczas leczenia, dostosowując wartości wyjściowe i oceniając wpływ w czasie.
Wyniki
Łącznie 140 kobiet zostało losowo przydzielonych do grup leczonych; 136 zostało uwzględnionych w analizach. Read more „Zmniejszenie poziomu RNA wirusa HIV-1 za pomocą terapii w celu powstrzymania wirusa Herpes Simplex”

Synteza DNA i naprawy genów RRM1 i ERCC1 w raku płuc

RRM1, podjednostka regulatorowa reduktazy rybonukleotydowej, bierze udział w karcynogenezie, progresji guza i odpowiedzi niedrobnokomórkowego raka płuc na leczenie. Metody
Opracowaliśmy zautomatyzowane ilościowe oznaczanie białka RRM1 w rutynowo przetwarzanych próbach histologicznych. W tych próbkach mierzyliśmy ekspresję RRM1 i dwóch innych białek, które są istotne dla niedrobnokomórkowego raka płuc: wycinanie naprawy krzyżowej grupy komplementacji (ERCC1) oraz fosfatazy i homologu tensyny (PTEN). Porównaliśmy wyniki z wynikami klinicznymi u 187 pacjentów z niedrobnokomórkowym rakiem płuca we wczesnym stadium, którzy otrzymali tylko leczenie chirurgiczne.
Wyniki
Ekspresja RRM1 korelowała z ekspresją ERCC1 (P <0,001), ale nie z ekspresją PTEN (P = 0,37). Read more „Synteza DNA i naprawy genów RRM1 i ERCC1 w raku płuc”

Wykorzystanie fragmentów Fab specyficznych dla digoksyny do intensywnego zatrucia u dzieci

Preparaty DIGITALIS, szeroko przepisywane dla dzieci i dorosłych z chorobami serca, 2 3 4 to silne leki, które w nadmiernych dawkach mogą mieć działanie na serce, żołądek i jelit, neurologię i metabolizm. Chociaż zdarzają się przypadki zatrucia naparstnicami u dzieci, 5 6 7 8 niewiele ekspozycji powoduje poważną toksyczność. Lewander i wsp. [9] opisali 41 przypadków zatrucia digoksyną u dzieci, które reprezentowały połączone doświadczenie trzech pediatrycznych ośrodków akademickich w ciągu 10 lat. Żadne z tych ostro zatrutych dzieci, których stężenia digoksyny w surowicy mieściły się w zakresie od 3,8 do 14,1 nmol na litr (3 do 11 ng na mililitr), cierpiało na zagrażające życiu zaburzenia rytmu serca lub zmarło.9 W 1976 r. Read more „Wykorzystanie fragmentów Fab specyficznych dla digoksyny do intensywnego zatrucia u dzieci”

Intrageniczna delecja genu KALIG-1 w zespole Kallmanna cd

Startery oligonukleotydowe stosowane w reakcji PCR były T312A (sekwencja, 5 CTTTCTAAGGTGCTAGCTAAGCC3 ) i 5771BP (sekwencja, 5 AGGGATTCATGCTCAAGGTATATTC3 ). Produkt PCR następnie subklonowano w wektorze M13 zgodnie ze standardowymi technikami 26 i sekwencjonowano przy użyciu fluorescencyjnego sekwencera Applied Biosystem ABI 370A, jak opisano w Gibbs et al.27. Wyniki
Ryc. 1. Wyniki analizy Southern Blot i amplifikacji PCR genu KALIG-1 u członków rodziny z zespołem Kallmanna powiązanym z chromosomem X. Read more „Intrageniczna delecja genu KALIG-1 w zespole Kallmanna cd”

Śmiertelny noworodkowy niedobór karnitynowej palmitoilotransferazy 2

Hug i wsp. (Wydanie z 26 grudnia) sugerują, że noworodki z niedoborem palmitoilotransferazy karnitynowej typu 2 można leczyć przez farmakologiczne zahamowanie palmitoilotransferazy karnitynowej typu w celu zmniejszenia tworzenia acylokarnityny o długim łańcuchu, która akumuluje się w wyniku podstawowego niedoboru enzymu. Jednak ta interwencja spowodowałaby wzrost poziomu długołańcuchowego acylokoenzymu A, związku, który hamuje wytwarzanie ATP.2 Faktycznie, akumulacja długołańcuchowej acylokarnityny podczas okresów postu może być pożądana u pacjentów z karnityną. niedobór palmitoiltransferazy typu 2, ponieważ ten ester karnityny zapobiega wchłanianiu wolnych kwasów tłuszczowych przez mięśnie szkieletowe i mięśnia sercowego poprzez hamowanie lipazy lipoproteinowej. Hamuje on również syntezę triglicerydów w mięśniach poprzez hamowanie acylotransferazy glicerolo-3-fosforanowej i zwiększenie poziomów wapnia domięśniowego, stymulując w ten sposób wytwarzanie wewnątrzkomórkowej lipazy. Read more „Śmiertelny noworodkowy niedobór karnitynowej palmitoilotransferazy 2”

Korelacja ekspresji antygenów H / LeY / LeB z przeżywalnością u pacjentów z rakiem płuca ad

Posturgiczny stan patologiczny każdego nowotworu sklasyfikowano zgodnie z układem przerzutowo-węzłowo-przerzutowym (TNM) 14 – to jest przez jego klasyfikację patologiczną (stadium I, II lub choroba IIIA), obecność i stopień przerzutów do węzłów chłonnych (N0 N1 lub N2) i rozmiar guza (T1, T2 lub T3). Ponieważ duża liczba źle zdefiniowanych czynników bierze udział w późnym stadium raka płuc (stadium IIIB i IV – tj. Ze stanem gorszym niż N3 i T4), wpływ pojedynczego czynnika, takiego jak dodatni wynik MIA, może być znacznie osłabiony i zasłonięte. Ponadto, ponieważ pięcioletni wskaźnik przeżywalności u pacjentów z chorobą stopnia IIIB i przerzutami N3 wynosi od 0 do 5 procent, rozważaliśmy analizę przeżycia takich pacjentów bezcelowo w kontekście niniejszego badania, a zatem wykluczono 52 pacjentów ze stadium Choroba IIIB lub IV. Ponieważ średnia długość życia japońskich mężczyzn i kobiet wynosi odpowiednio 78 i 81 lat, przebadaliśmy tylko pacjentów w wieku od 32 do 73 lat, wykluczając w ten sposób 10 pacjentów powyżej 74 roku życia. Read more „Korelacja ekspresji antygenów H / LeY / LeB z przeżywalnością u pacjentów z rakiem płuca ad”

Salmeterol i propionian flutykazonu i przeżycie w przewlekłej obturacyjnej chorobie płuc ad 9

To odkrycie nie było wcześniej zgłaszane w badaniach dotyczących stosowania wziewnych kortykosteroidów przez pacjentów z POChP. Ponieważ odkrycie było nieoczekiwane, nie było prospektywnej definicji zapalenia płuc w protokole badania (np. Potwierdzenie na radiografii klatki piersiowej). Jednak to odkrycie zaobserwowano w różnych podgrupach, co sugeruje, że może to być ważny sygnał, którego mechanizm jest obecnie niejasny i wymaga dalszych badań. Wzrost w zapaleniu płuc nie wydawał się reprezentować wzrostu liczby zgonów. Read more „Salmeterol i propionian flutykazonu i przeżycie w przewlekłej obturacyjnej chorobie płuc ad 9”

Salmeterol i propionian flutykazonu i przeżycie w przewlekłej obturacyjnej chorobie płuc ad

Aby przetestować tę hipotezę, podjęliśmy próbę rewolucji w kierunku POChP, podwójnie zaślepionym, kontrolowanym placebo, randomizowanym, równoległym badaniem porównującym salmeterol i propionian flutykazonu (schemat skojarzonego podawania) z każdym z tych składników oddzielnie. i placebo w okresie 3 lat. Metody
Szczegóły dotyczące projektu badania i planu analizy zostały opublikowane wcześniej. 14. Pełny protokół badania znajduje się w Dodatku 1, dostępnym wraz z pełnym tekstem tego artykułu na stronie www.nejm.org. Read more „Salmeterol i propionian flutykazonu i przeżycie w przewlekłej obturacyjnej chorobie płuc ad”